pcr conditions and primer sequences Search Results


primers for polymerase chain reaction (pcr) amplification and tp53 sequencing  (Metabion International AG)
90
Metabion International AG primers for polymerase chain reaction (pcr) amplification and tp53 sequencing
Primers For Polymerase Chain Reaction (Pcr) Amplification And Tp53 Sequencing, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/primers+for+polymerase+chain+reaction++pcr++amplification+and+tp53+sequencing/pmc06820874__41598_2019_51735_MOESM1_ESM-1-148-178
Average 90 stars, based on 1 article reviews
primers for polymerase chain reaction (pcr) amplification and tp53 sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
primers for dna sequencing  (GeNOsys Inc)
90
GeNOsys Inc primers for dna sequencing
Primers For Dna Sequencing, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+and+sequencing+primers/10__1016_slash_s0928___8244_ascii40_03_ascii41_00103___2-61-0-4
Average 90 stars, based on 1 article reviews
primers for dna sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
real-time pcr sequences  (PrimerDesign Inc)
90
PrimerDesign Inc real-time pcr sequences
Real Time Pcr Sequences, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+and+sequencing+primers/pm24475013-78-3-0
Average 90 stars, based on 1 article reviews
real-time pcr sequences - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
pcr primer sequences  (BIOTAGE)
90
BIOTAGE pcr primer sequences
Pcr Primer Sequences, supplied by BIOTAGE, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+and+sequencing+primers/pm17921385-75-0-16
Average 90 stars, based on 1 article reviews
pcr primer sequences - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
oligonucleotide primers used for pcr and dna-sequencing  (MWG-Biotech ag)
90
MWG-Biotech ag oligonucleotide primers used for pcr and dna-sequencing
Oligonucleotide Primers Used For Pcr And Dna Sequencing, supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/oligonucleotide+primers+used+for+pcr+and+dna+sequencing/pm26681805-184-6-10
Average 90 stars, based on 1 article reviews
oligonucleotide primers used for pcr and dna-sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
primer synthesis and sequencing of pcr products or plasmids  (GenScript corporation)
90
GenScript corporation primer synthesis and sequencing of pcr products or plasmids
Primer Synthesis And Sequencing Of Pcr Products Or Plasmids, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/primer+synthesis+and+the+sequencing+of+pcr+products+or+plasmids/10__1128_slash_jb__00077___19-133-6-14
Average 90 stars, based on 1 article reviews
primer synthesis and sequencing of pcr products or plasmids - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
pcr primers specific to methylated and unmethylated sequences  (Medprobe Inc)
90
Medprobe Inc pcr primers specific to methylated and unmethylated sequences
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
Pcr Primers Specific To Methylated And Unmethylated Sequences, supplied by Medprobe Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+primers+specific+to+methylated+and+unmethylated+sequences/pmc00548671-59-17-32
Average 90 stars, based on 1 article reviews
pcr primers specific to methylated and unmethylated sequences - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
pcr and sequencing primers  (Microsynth ag)
90
Microsynth ag pcr and sequencing primers
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
Pcr And Sequencing Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+and+sequencing+primers/pm28365704-41-1-8
Average 90 stars, based on 1 article reviews
pcr and sequencing primers - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
pcr primers synthesis and sequencing  (GenScript corporation)
90
GenScript corporation pcr primers synthesis and sequencing
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
Pcr Primers Synthesis And Sequencing, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/pcr+primers+synthesis+and+sequencing/pm39300116-59-0-8
Average 90 stars, based on 1 article reviews
pcr primers synthesis and sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
all pcr primers  (GeneLink Biosciences)
90
GeneLink Biosciences all pcr primers
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
All Pcr Primers, supplied by GeneLink Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/primers+for+pcr+and+sequencing/pmc02952493-82-15-20
Average 90 stars, based on 1 article reviews
all pcr primers - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
alternate rt-pcr and/or sequencing primers a3, a4, b4, c4, f1, g1, and h1  (Celera)
90
Celera alternate rt-pcr and/or sequencing primers a3, a4, b4, c4, f1, g1, and h1
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
Alternate Rt Pcr And/Or Sequencing Primers A3, A4, B4, C4, F1, G1, And H1, supplied by Celera, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/alternate+rt+pcr+and+or+sequencing+primers+a3++a4++b4++c4++f1++g1++and+h1/pmc03588119-134-16-16
Average 90 stars, based on 1 article reviews
alternate rt-pcr and/or sequencing primers a3, a4, b4, c4, f1, g1, and h1 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier
oligonucleotide primers for rt-pcr amplification and sequencing  (PrimerDesign Inc)
90
PrimerDesign Inc oligonucleotide primers for rt-pcr amplification and sequencing
Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of <t>unmethylated</t> alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software
Oligonucleotide Primers For Rt Pcr Amplification And Sequencing, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcr+conditions+and+primer+sequences/oligonucleotide+primers+for+rt+pcr+amplification+and+sequencing/pm15476884-137-6-11
Average 90 stars, based on 1 article reviews
oligonucleotide primers for rt-pcr amplification and sequencing - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of unmethylated alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software

Journal: Molecular Cancer

Article Title: The loss of NKX3.1 expression in testicular – and prostate – cancers is not caused by promoter hypermethylation

doi: 10.1186/1476-4598-4-8

Figure Lengend Snippet: Representative results of the methylation analyses of the NKX3.1 promoter. (A) Methylation-specific PCR. A visible PCR product in Lanes U indicates the presence of unmethylated alleles whereas a PCR product in Lanes M indicates the presence of methylated alleles. The left panel illustrates the methylation status of selected TGCTs and the testicular cancer cell lines. Note the methylation of sample # 2110. The right panel shows the unmethylated status of primary prostate cancers and prostate cancer cell lines. Abbreviations: NB , normal blood (positive control for unmethylated samples); IVD , in vitro methylated DNA (positive control for methylated samples); neg , negative control (containing water as template); U , lane for unmethylated MSP product; M , lane for methylated MSP product. (B) Bisulphite sequencing. The bisulphite sequence allows a positive display of 5-methyl cytosines in the gene promoter as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence. The left chromatogram represents a part of the unmethylated NKX3.1 promoter in the germ cell tumor cell line TERA2, including 11 CpG sites marked by underlined letters. The right chromatogram represents the unmethylated prostate cancer cell line DU145. Both sequences have been generated by reversing the respective anti-sense sequences by use of the software "Chromas".

Article Snippet: All samples were subsequently submitted to MSP analysis [ ] using PCR primers specific to methylated and unmethylated sequences: NKX3.1 unmethylated sequence, sense: 5'GGAAAGTGAAAGTGGTGTGGGTT3', antisense: 5'CTACACACCATCCCACAAAATATC3', methylated sequence, sense: 5'AAAGTGAAAGCGGTGCGGGTC3', antisense: 5'ACGCGCCGTCCCGCAAAATAT3' (MedProbe AS, Oslo, Norway).

Techniques: Methylation, Positive Control, In Vitro, Negative Control, Bisulfite Sequencing, Sequencing, Generated, Software